Interleukin-4 Gene Polymorphisms in Type 2 Diabetes Mellitus in
Medan, Indonesia
Milahayati Daulay
1
, Mutiara Indah Sari
2
1
Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia
2
Department of Biochemistry, Faculty of Medicine, Universitas Sumatera Utara, Medan, Indonesia
Keywords: Interleukin-4 Gene, Polymorphisms, Diabetes Mellitus.
Abstract: Chronic hyperglycemia in type 2 diabetes mellitus is associated with the production of proinflammatory
cytokines such as Interleukin (IL)-1, Tumor Necrosis Factor (TNF), Interferon (IFN)-c, IL-6, IL-12, and IL-
18. This inflammatory condition triggers the formation of anti-inflammatory cytokines such as IL-4, IL-10,
IL-13, and IFN-α that work antagonistically against the pro-inflammatory cytokines. Interleukin-4 gene
polymorphisms are associated with inflammatory events arising from hyperglycemic conditions. This study
aims to determine the polymorphism of IL-4 -33 C>T gene in diabetic patients. A total of 40 diabetic patients
from Universitas Sumatera Utara Hospital, Medan were genotyped for IL-4 SNPs (single nucleotide
polymorphisms) -33 C>T using restriction fragment length polymorphism-polymerase chain reaction (RFLP-
PCR). Genotype frequencies were calculated in patients by direct gene counting. The most frequent genotype
in diabetic patients from Universitas Sumatera Utara Hospital in Medan was TT in 20 patients (50%). The
frequency of CT genotype was 18 (45%) and CC genotype was 2 (5%). Previous studies have shown
differences in genotype frequencies in other regions indicating a genetic factor difference in diabetes mellitus.
Based on the result of present study it may be concluded that the functional gene polymorphisms of IL-4 play
an important role in type 2 diabetes mellitus.
1 INTRODUCTION
Epidemiological studies have shown a tendency to
increase incidence rates and the prevalence of type 2
Diabetes Mellitus (DM) in different parts of the
world. The World Health Organization (WHO)
predicts an increase in the number of people with DM
who become one of the global health threats. In
Indonesia, WHO predicts an increase in the number
of people with DM from 8.4 million in 2000 to about
21.3 million by 2030. This report shows an increase
in the number of people with DM 2-3 times by 2035.
The International Diabetes Federation (IDF) predicts
an increase in the number of people with DM in
Indonesia from 9.1 million in 2014 to 14.1 million by
2035 (PERKENI, 2015).
According to the American Diabetes Association
(ADA) 2010, diabetes mellitus is a group of
metabolic diseases with characteristic hyperglycemia
that occurs because of abnormalities of insulin
secretion, insulin resistance or both. Chronic
hyperglycemia in DM is associated with the
production of proinflammatory cytokines and
inflammatory cytokines through Toll-Like Receptors
(TLRs) 2 and 4 activation resulting in destruction of
pancreatic beta cells and pancreatic endocrine
dysfunction in type 1 and 2 DM. This is characterized
by changes in proinflammatory cytokine levels such
as interleukin IL-1, Tumor Necrosis Factor (TNF),
Interferon (IFN) -c, IL-6, IL-12, and IL-18 in DM
patients (Frances, 2013). This inflammatory
condition triggers the formation of anti-inflammatory
cytokines such as IL-4, IL-10, IL-13, and IFN-α that
work antagonistically against the pro-inflammatory
cytokines (Voehringer, 2013)
Several studies have shown that there is an
association of IL-4 cytokine gene expression with
metabolic abnormalities of diabetes mellitus.
Interleukin-4 gene polymorphisms and changes in IL-
4 levels are associated with inflammatory events
arising from hyperglycemic conditions. (Tripathi,
2015) in his study showed the association of IL-4
genotypic polymorphism with type 2 DM in the
Indian population. Type 2 DM is known to be
associated with IL-4-590 C> T gene polymorphism
with increased CT variant in type 2 diabetes mellitus
Daulay, M. and Sari, M.
Interleukin-4 Gene Polymorphisms in Type 2 Diabetes Mellitus in Medan, Indonesia.
DOI: 10.5220/0010078905750577
In Proceedings of the International Conference of Science, Technology, Engineering, Environmental and Ramification Researches (ICOSTEERR 2018) - Research in Industry 4.0, pages
575-577
ISBN: 978-989-758-449-7
Copyright
c
2020 by SCITEPRESS – Science and Technology Publications, Lda. All rights reserved
575
compared with healthy control (Alsaid, 2013). (Li,
2013) found an association between IL-10- 1082 G /
A gene polymorphism with type 2 diabetes mellitus.
(Bid, 2008) also found an association between IL-4
and IL-1RN (VNTR) gene polymorphisms with the
incidence of type 2 diabetes mellitus. This study aims
to determine the polymorphism of IL-4 -33 C> T gene
in diabetic patients at Universitas Sumatera Utara
Hospital, Medan.
2 METHOD
The study was conducted in Universitas Sumatera
Utara Hospital and Integrated Laboratory of Medical
Faculty Universitas Sumatera Utara. To be eligible
for the study, patients had to give informed consent.
The study protocol was reviewed and approved by the
Research Ethical Committee Faculty of Medicine,
Universitas Sumatera Utara. All participants provided
written informed consent to participate in this study.
The type of this research is descriptive research
with cross sectional study approach with the number
of samples as much as 40 patients with type 2 diabetes
mellitus at Universitas Sumatera Utara Hospital,
Medan. Venous blood taken as much as 5 cc. DNA
isolation using kit from Promega. Examination of
interleukin-4 -33 C> T polymorphisms with PCR-
RFLP technique using BSmAI restrictive enzyme and
electrophoresis at 2% agarose. Primer F IL-4 -33 C>
T Primer F (forward)
CAAGTTACTGACAATCTGGTGT Primer R
(reverse) CGGCACATGCTAGCAGGAA with a
large PCR product of 223 bp. The genotype
frequencies are calculated directly.
3 RESULTS AND DISCUSSIONS
Table 1 shows the charateristics of respondents. Most
of the diabetic patients in Universitas Sumatera Utara
Hospital in Medan are male (52.5%) and more
common in the age between 40 -70 years as many as
33 patients (82.5%).
Table 1: Charateristics of respondents (n= 40).
Charateristics
n
%
Sex
Male
Female
21
19
52.5
47.5
Age
< 40
40-70
>70
1
33
6
2.5
82.5
15
Current study showed that type 2 diabetes mellitus
occurs most commonly in men. According to
(Ferguson, 2017), the high prevalence of diabetes in
men can be caused by several factors such as higher
visceral fat in males where visceral fat is associated
with high fat in the liver and pancreas. This risk
difference is influenced by the distribution of body
fat. In men, fat accumulation is concentrated around
the abdomen that triggers central obesity, which is
more at risk of triggering metabolic disorders. In
other words, men are more susceptible to diabetes
than women. In addition, hormonal factors also play
a role in high prevalence of diabetes in men. In this
study also found that diabetes mellitus type 2 is most
common in adults older than 40 years. The presence
of decreased function of organs due to aging causes
decreased work of the organ including the pancreas.
According to Indonesian Society of Endocrinologists,
age over 40 years is one of the risk factors for the
occurrence of type 2 diabetes mellitus (PERKENI,
2015).
Table 2: Distribution of frequency of genotypes.
Genotypes
CC
CT
TT
n (%)
2 (5)
18
(45)
20
(50)
Analysis of the polymorphisms at -33 C>T of IL-
4 by BSmAI restriction enzyme showed that the
frequency of the TT genotype was 20 (50%) . The
frequency of CT genotype was 18 (45%) and CC
genotype was 2 (5%).
Figure 1: RFLP-PCR product of IL-4 gene -33 C>T.
Mechanisms of various diseases such as infection,
autoimmune, malignant disease are affected by the
production of proinflammatory and antiinflammatory
cytokines (Bidwell, 1999). The difference in gene
expression brought by differences in gene sequence
ICOSTEERR 2018 - International Conference of Science, Technology, Engineering, Environmental and Ramification Researches
576
concludes how the mechanism and development of a
disease (Sari and Sari, 2017). The presence of
different cytokine profiles among individuals
indicates the presence of gene polymorphisms that
produce these cytokines. This study showed
polymorphism of IL-4 -33 C>T gene in diabetic
patients where the TT genotype has the largest
frequency among people with type 2 diabetes mellitus
in Medan, North Sumatera, Indonesia. This is in
contrast to the results obtained by (Alsaid, 2013) in
Egypt, where in the type 2 diabetes mellitus patients,
most genotypes were CT and in Pakistan by (Micheal,
2013), the highest genotypes were CC in patients with
asthma and allergic rhinitis. Meanwhile, in Iran, by
(Arababadi, 2010) found the most genotype is CC in
patients with type 2 diabetes mellitus. This indicates
that the interleukin-4 gene polymorphisms have an
effect on the occurrence of diabetes mellitus.
4 CONCLUSIONS
In this study, we found the presence of interleukin-4
gene polymorphism in type 2 diabetes mellitus in
Medan, North Sumatera, Indonesia. The functional
gene polymorphisms of interleukin-4 play an
important role in type 2 diabetes mellitus. Further
research is needed to compare interleukin-4 gene
polymorphisms with the control group.
ACKNOWLEDGEMENTS
Authors are grateful to the Ministry of Research and
Technology and Higher Education of Republic
Indonesia. This work was supported by research
grants from TALENTA USU 2018 contract number
2590/UN5.1.R/PPM/2018 date 16 March 2018.
REFERENCES
Alsaid, A., El-Missiry, M., Hatata, E., Tarabay, M., Settin.,
M. 2013. Association of IL-4-590 C>T and IL-13-1112
C>T Gene Polymorphisms with the Susceptibility to
Type 2 Diabetes Melitus. Disease Markers, 35(4), 243-
247
American Diabetes Association (ADA). 2010, Diagnosis
and Classification of Diabetes Melitus. Diabetes Care,
37(1), 81–90
Arababadi, M. K. , 2010. Interleukin-4 gene
polymorphisms in type 2 diabetic patients with
nephropathy. Iranian Journal of Kidney Diseases, 4(4),
302-306
Bid, H. K., Konwar, R., Agrawal, C. G., Banerjee, M. 2008.
Association of IL-4 and IL-1RN (receptor antagonist)
gene variants and the risk of type 2 diabetes mellitus: a
study in the north Indian population. Indian J Med Sci.,
62(7), 259-266
Bidwell, J., Keen, L., Gallagher, G., Kimberly, R.,
Huizinga, T., McDermott, M. F., Oksenberg, J.,
McNicholl, J., Pociot, F., Hardt, C., Alfonso, S. D.
1999. Cytokine gene polymorphism in human disease:
on-line databases. Genes and Immunity, 1, 3–19
Francés, D. E., Ingaramo, P.I., Ronco, M. T., Carnovale, C.
E. 2013. Diabetes, an inflammatory process: Oxidative
Stress and TNF-alpha involved in hepatic complication.
J. Biomedical Science and Engineering, 6, 645-653
Ferguson, L. D., Celis-Morales, C., Ntuk, U. E., Mackay,
D. F., Pell, J. P., Gill, J. M. R., Satta, N. 2017. Men
across a range of ethnicities have a higher prevalence of
diabetes: findings from a cross-sectional study of
500000 UK Biobank participants. Diabetes Medicine,
1-16
Li, J., Wu, S., Ming-Rui, W., Ting-Ting, W., Ji-Min, Z.
2013. Association of the interleukin-10 − 592A/C, −
1082G/A and − 819T/C gene polymorphisms with type
2 diabetes: A meta-analysis. Gene, (5)21, 211-216
Micheal, S., Minhas, K., Ishaque, M., Ahmed, F., Ahmed,
A. 2013. IL-4 Gene Polymorphisms and Their
Association With Atopic Asthma and Allergic Rhinitis
in Pakistani Patients. J Investig Allergol Clin Immunol,
23(2), 107-111
Perkumpulan Endokrinologi Indonesia (PERKENI). 2015,
Pengelolaan dan Pencegahan Diabetes Melitus Tipe 2
di Indonesia. PB. PERKENI. Jakarta, 5
th
edition
Sari, M. I., Sari, D. I. 2017. Nutrient Intake Apolipoprotein
A5 -1131T>C Polymorphism and Its Relationship with
Obesity. IOP Conference Series: Materials Science and
Engineering.180. 012094
Tripathi, A. K., Smriti, S., Jitendra, K. T., Rishabh, D. S.,
Srikant, K., Pranav, M., Ugam, K. C., Manoj, I. 2015.
Association of Genetic Polymorphism of Inflammatory
Genes (IL-1β and IL-4) with Diabetes Type 2. Journal
of Genetic, Molecular and Cellular Biology, 2(1), 1-9
Voehringer, D., Reese, T. A., Huang, X., Shinkai, K.,
Locksley, R. M. 2006. Type 2 immunity is controlled
by IL-4/IL-13 expression in hematopoietic non-
eosinophil cells of the innate immune system. Journal
of Experimental Medicine, 203(6) 1435–1446
Interleukin-4 Gene Polymorphisms in Type 2 Diabetes Mellitus in Medan, Indonesia
577